University of South Florida St. Petersburg
FALL GENOME FESTIVAL

In order to commemorate the 10th anniversary of the Human Genome Project, USFSP has invited Miami artist Xavier Cortada and Dr. Kalai Mathee (FIU Department of Molecular Microbiology and Infectious Diseases Founding Chair) to present a plenary lecture on November 3rd, 2011.  They will discuss “Sequentia,” their 2010 DNA-themed multidisciplinary project at the Florida International University’s Frost Art Museum (see below).

Cortada will conduct an art/science workshop with USFSP art students on the morning of November 3rd.  Cortada’s DNA-themed art work will also be on display at the USF St. Petersburg Nelson Poynter Memorial Library.

Sequentia

Xavier Cortada’s solo exhibit at the Frost Art Museum explored the sequence of events that make up life on the planet from the molecular to the monumental.

The title of the exhibit also referenced a series of actions Cortada set in motion to create of a unique strand of DNA. The artist worked with a molecular biologist to synthesize an actual DNA strand made from a sequence generated by museum visitors using Cortada’s art.

In The Four Nucleotides, the artist created large scale “portraits” of Adenine, Cytosine, Guanine and Thymine– the four bases of a DNA strand that summarize all we are, were and will be.

Xavier Cortada, “(The Four Nucleotides:) Thymine,” oil on canvas, 60″ x 48″, 2010.		Xavier Cortada, “(The Four Nucleotides:) Adenine,” acrylic on canvas, 60″ x 72″, 2010.

 

Participatory Installation

In Genetic Sequence, the artist invited museum visitors to randomly select a post card depicting one of Cortada’s four nucleotide paintings and place them sequentially within small plastic bags hanging in a grid on a wall.

In placing the nucleotide postcards, the visitors assisted in the development of a DNA strand as part of a participatory installation.

above: screen grabs courtesy of wetheat.tv

LabARTory Sessions

Two weeks into the exhibit, the artist engaged in a series of LabARTory Sessions with Dr. Kalai Mathee, FIU Department of Molecular Microbiology and Infectious Diseases Founding Chair.

In her lab, Cortada determined whether or not the random sequence being generated by the participatory art project existed anywhere in the human genome.

During these performative sessions, Cortada used the sequence to create a live DNA strand, inserted (cloned) it into a vector (plasmid) and propogated it in a bacteria on a Petri dish.

The presence of the specific DNA strand was also analyzed using agarose gel electrophoresis, sequenced and analyzed against other existing DNA sequences.

Once they became available, the results were exhibited in the museum alongside the Petri dish and a microfuge tube filled with the amplified DNA molecule.

Above: Xavier Cortada, “(The Four Nucleotides:) Guanine,” acrylic on canvas, 60″ x 72″, 2010.

Results

TCTAATACAATCCCTACGTGACTGTGTATAAATGTGAAAGCTATATTAATGTCGCAGCTAGTCTCATAAAAGATTCCTACAACGCGACGGATCTATACCTATGCCATAGTCCCAGCTTTTACTTATTCTCACAATTTTACATTTTTGGGCCAACAGGACCGTCCTCATGCTTACCATATTCCTTCAGCTTAATATAGCTGATCTCTACACTCAAACCACCTCGTGTGCTGGTCTCGAGAGTTGCCCTTACCCGAGGCTTGGTGTACTGGGTGTAAGTAAAAGTTGGATAGGCCCGTCCTTGGAGACGTCGAACTAATTTTGAGAGCGCATCTGCTTCCATACTTGTATCCCTGTTGTCCTTCGGCACACGTGGAACTGACTTGCCTCAAAAAGGGTAACA

Was the random sequence (above) generated by the participatory art project similar to a DNA sequence found anywhere in the human genome?

Yes!  A portion of the sequence was similar to the portion of human Chromosome 3 which encodes for proteins that direct the navigation of axons in human neurons!

On November 10th, 2010, using the participants’ sequence, Cortada synthesized the 400-nucleotide DNA molecule and named it “Sequentia.”

Xavier Cortada, “(The Four Nucleotides:) Cytosine,” oil on canvas, 60″ x 48″, 2010.